Introduction

Bowtie is a powerful, efficient and fast bioinformatics program designed to align short genetic sequence reads with low memory requirements and efficient data indexing.

Running Bowtie on RCC Resources

Bowtie 1.0.0 is installed in HPC and Spear.

Serially running Bowtie on Spear

Following example shows how to use basic bowtie commands.

Download e_coli_1000.fq file. Then run the command,

bowtie e_coli e_coli_1000.fq

You will see bowtie print many lines of output. Each line is an alignment for a read. The name of the aligned read appears in the leftmost column.

bowtie -t e_coli reads/e_coli_1000.fq e_coli.map

will write the output to the file e_coli.map.

We are going to create a new index from the sequence of E. coli strain O157:H7, a strain known to cause food poisoning. Download the sequence file NC_002127.fna.

bowtie-build NC_002127.fna e_coli_O157_H7

When the command is completed, note that the current directory contains four new files named e_coli_O157_H7.1.ebwt, e_coli_O157_H7.2.ebwt, e_coli_O157_H7.rev.1.ebwt, and e_coli_O157_H7.rev.2.ebwt. These files constitute the index. Move these files to the indexes subdirectory to install it.

To test that the index is properly installed, issue this command:

bowtie -c e_coli_O157_H7 GCGTGAGCTATGAGAAAGCGCCACGCTTCC

If the index is installed properly, this command should print a single alignment and then exit.

bowtie-build NC_002127.fna e_coli_O157_H7

Parallaly Running Bowtie on HPC

Following script shows how to run the above example on HPC using SLURM job scheduler.

#!/bin/bash

#SBATCH -p genacc_q
#SBATCH -J BowtieJob

bowtie e_coli e_coli_1000.fq
bowtie -t e_coli reads/e_coli_1000.fq e_coli.map
bowtie-build NC_002127.fna e_coli_O157_H7
bowtie-build NC_002127.fna e_coli_O157_H7

For a complete list of commands, refer to Bowtie manual.